Skip to main content

Advertisement

Table 1 The PCR primer sequences for scanning COMMD1 gene in WD patients

From: A novel COMMD1 mutation Thr174Met associated with elevated urinary copper and signs of enhanced apoptotic cell death in a Wilson Disease patient

Exon Forward primer (5' - 3') Reverse primer (5' - 3') Amplicon size (bp)
1 GTGGTGGTTTTGCACAGGC TCCAAGCCGGAGACTACAG 301
2 TTCAGTGATTTAAGAGTCACTC GAATAGACAAGCTAACATGTAG 456
3 GAGTTTGGTCATGCCAGATG GTGAGAACCTCTGCACTGG 379
  1. All these PCR primers were also used for sequencing COMMD1.