Skip to main content

Table 1 Information of the primers and PCR-RFLP Analysis of seven SNPs in DISC1 gene

From: Evidence for association between Disrupted-in-schizophrenia 1 (DISC1) gene polymorphisms and autism in Chinese Han population: a family-based association study

SNP Position Primer sequence (5'-3') Product (bp) RFLP Allele (bp)
rs4366301 Intron 1 F: AGAAGACTAGGAAAAATAACT
R: ATAAACACTGAACAGAATGTC
406 ScrFI C: (43/265/98) G: (43/363)
rs11585959a Intron 2 F: TGACATTCTACCTTCTCTCTC
R: ACTACCTTTATTACCATCTTC
556 - - -
rs1322784 Intron 6 F: CCTCCTCTGTTGAAAGTAGGT
R:GGAAGAAAGTCTGAATGTGAC
645 Van91I A: (201/444) G: (645)
rs6668845 Intron 9 F:AAAAAAAAAAAATCAACTGAG
R:CCCAAATCTTTCATAGTGACT
572 TaiI G: (442/130) A: (572)
rs10864698 Intron 9 F: TCCAGAGCCAGTGAAATGTTC
R: TTGTGCCTGAATGAATGAGAC
630 MunI A: (381/249) G: (630)
rs872624 Intron 9 F: ACAAAACCAGAAACCTTGAGT
R: ACATATTAGGGAAACTGAATG
757 NdeI G: (506/251) A: (757)
rs821616 Exon 11 F: GTATTGGGCTGCTGAGTCTG
R: GACCTCTTTCTGTTCACCTCC
540 Bsrl T: (204/336) A: (540)
  1. PCR-RFLP, polymerase chain reaction-restriction fragment length polymorphism; SNP, single nucleotide polymorphism; F, forward; R, reverse.
  2. adirect sequencing was applied for rs11585959.
\