Skip to main content

Advertisement

Table 1 Primer sequences used for real-time PCR

From: Experimental gastritis leads to anxiety- and depression-like behaviors in female but not male rats

Target Forward (5′- 3′) Reverse (5′- 3′)
GAPDH ATGACTCTACCCACGGCAAG TACTCAGCACCAGCATCACC
c-fos CCGACTCCTTCTCCAGCAT TCACCGTGGGGATAAAGTTG
CRF GTTGAATTTCTTGCAACCGGAG GACTTCTGTTGAGGTTCCCCAG
GR AGGGGAGGGGGAGCGTAATGG CCTCTGCTGCTTGGAATCTGC