Skip to main content

Advertisement

Table 1 Sequences of the primers used for genotyping by Multiplex PCR and SNaPshot analysis

From: Association between 5q23.2-located polymorphism of CTXN3 gene (Cortexin 3) and schizophrenia in European-Caucasian males; implications for the aetiology of schizophrenia

SNP Primers Multiplex Primer for SNaPshot extension
rs6595788 GATGGGCTGTTTTGACACCTA A (T) 12TGGTTTAGGAATATTTAAAATACAGACAGC
  CAACGCCAAATGATGGTAGAT   
rs17817356 GGAGAATGTGAGTCATGATGTGA A (T)4ATAACTAAACGTTCAAGTATTTCCCT
  ATCTGACCAAAATCAGGCACA   
rs821597 GGTCCAGAGACATGAGTTTGC A (T)9GAGTTTGCCATCAGGCAATAATGAATT
  ATGGCCAAACCTTGCTTTAGT   
rs9661837 ATGAACTGGTCACATGGCACT B (T)4TGGCACTTGGAATCCTTGAGTT
  CACTTGGGCTAGTGACGGTTA   
rs980989 CCAGAAACATGTAACGGTTGG B TGCCATGCTAAGCCCTTTACA
  ATGCTGCCTGTCTCTGACTGT   
rs3737597 CAAATGGCACAGGAAAAAGAG B (T)10CTATTCTCAAATCCTGTGGAAGACATTC
  CAGTGGAAAGGTGGTTCATGT