Skip to main content

Table 2 Primer sequences and conditions for real-time PCR and the following HRM analysis of the examined MDR1 C3435T

From: Association between C3435T polymorphism of MDR1 gene and the incidence of drug-resistant epilepsy in the population of Polish children

Target Primers (5′–3′) PCR cycling (40 cycles) HRM
Denaturation Annealing Extension
rs1045642 Forward: TCCTGAAGTTGATCTGTGAAC
Reverse: AGTGACTCGATGAAGGCA
30 s for 95 °C 30 s for 58 °C 30 s for 72 °C 75–90 °C