Skip to main content

Table 1 Specific primers used in real-time PCR analysis

From: Effects of GABAB receptors in the insula on recognition memory observed with intellicage

Gene Primer Sequence (5′→3′)
GAPDH FW
RV
GAGTCAACGGATTTGGTCGT
GACAAGATTCCCGTTCTCAG
GB1 FW
RV
AGATTGTGGACCCCTTGCAC
AGAAAATGCCAAGCCACGTA
GB2 FW
RV
CACCGAGTGTGACAATGCAAA
CCAGATTCCAGCCTTGGAGG
\