Skip to main content

Table 1 Specific primers used in real-time PCR analysis

From: Differential responses of stressful elements to predatory exposure in behavior-lateralized mice

Gene Forward Reverse
CRH 5′CACCTACCAAGGGAGGAGAA 3′ 5′CAGAGCCACCAGCAGCAT 3′
GR 5′ATGGGCAAAGGCGATACCAGGATT 3′ 5′CCAACCCAGGGCAAATGCCATGA 3
GAPDH 5′GTGACTTCAACAGCAACTCCCATT3′ 5′GTTATGGGGTCTGGGATGGAATTGTG3′