Skip to main content

Table 1 PCR primers, annealing temperatures for PCR and the restriction enzymes used to detect different DRD2 polymorphisms.

From: Association of dopamine receptor polymorphisms with schizophrenia and antipsychotic response in a South Indian population

Polymorphism Primers Annealing temp. Restriction Enzyme
Taq1B F 5'GATACCCACTTCAGGAAGTC 3'
R 5'GATGTGTAGGAATTAGCCAGG 3'
60°C Taq1A
Taq1D F 5'CCCAGCAGGGAGAGGGAGTA 3'
R 5'GACAAGTACTTGGTAAGCATG 3'
60°C Taq1A
S311C F 5'TTGGGCATGGTCTGGATCTCAAA 3'
R 5'CCAGCTGACTCTCCCCGACCGGT 3'
65°C Sau961
H313H F 5'ATCCTGCAGCCATGG 3'
R 5'ATTGTCCGGCTTTACC 3'
55°C Nco1
Taq1A F 5'CCCTTCCTGAGTGTCATCA 3'
R 5'CGGCTGGCCAAGTTGTCTA 3'
58°C Taq1A
\