Skip to main content

Advertisement

Table 1 Primers used in this study

From: The adenosine A2A receptor is associated with methamphetamine dependence/psychosis in the Japanese population

Exon Forward Reverse
Exon 1 1F: GAGGTCCATTTGGATCCAGACCAT 1R: TTCTCTCGCCAGGCCAACTTCTCA
  2F: ACATCCTTCCACATCCGAGCTCCA 2R: CAGGCCAGGTGTCAGCCTGAGGAT
  3F: AGTCTCAGCGGGAATTCTATTGGA 3R: GACGAAGCAGGCAATGAAGAGGCA
  4F: TACATCACGGTGGAGCTGGCCATT 4R: ACAGCTCCCTGCTAAGCCCAATGC
Exon 2 5F: ACTACTCAATGACCATCTGGGCAT 5R: TGATGGCCAGTGACTTGGCAGCAT
  6F: TGCTGCTCATGCTGGGTGTCTATT 6R: TCTTCTCCCAACGTCACTGGTCAA
  7F: TTAGCCATGAGCTCAAGGGAGTGT 7R: CTCTGGCACTGCTCTGTTACAACT
  8F: TCACTCTCTGGCTGCTGGGTCTGC 8R: GTCACAGTTCTGAGAAGGTAACAT