Skip to main content

Advertisement

Table 1 Information of TaqMan assays and context sequences of 6 SNPs examinaed

From: A case-control association study of NRXN1 polymorphisms with schizophrenia in Chinese Han population

ID SNPs Position Location Context Sequence ([VIC/FAM])
1 rs10490168 50988978 intron TGAATTGATAAAACAGTAACACTGA[C/T]AAAAATACATACACACATTCACACAC
2 rs2024513 51005523 intron GAAGTGTTCTTTCTTAGATACATGA[A/G]GTCTTGGTAACCTTAATGGCTATTT
3 rs10174398 51049105 intron ACCAGTCCACCTCTATCTGTACCCA[C/T]GCTCTCTCCATATAATGTTCTTCTC
4 rs10195460 51082210 intron CTAAAGGGAGATCAATTAAGCATAC[A/G]TTTTTCCACCTTTTAAAATAATACT
5 rs13382584 51100798 intron TCTTTACAAATGTAACCACCACCCA[C/T]ATCATGCCCAATGCTCCATTGTTTT
6 rs1558852 51105641 intron TTAATACATGATCTGTATTGGGAGA[A/G]TCATCCATTCTCAATTAATTATTCA