Skip to main content

Advertisement

Table 1 Primer sequences for the semi-quantitative RT-PCR

From: An anxiogenic drug, FG 7142, induced an increase in mRNA of Btg2 and Adamts1 in the hippocampus of adult mice

Official Symbol of Gene Gene name Gene Bank ID Bases spanned Forward primer (5' to 3') Reverse primer (5' to 3')
Gapdh NM_001001303. 211-439 CGGCAAATTCAACGGCACAGTCAA TGGGGGCATCGGCAGAAGG
Glyceraldehyde-3-phosphate dehydrogenase     
Btg2 NM_007570 479-597 CC CCCCGGTGGCTGCCTCCTATG GGGTCGGGTGGCTCCTATCTA
B-cell translocation gene 2     
Adamts 1 NM_009621. 550-896 GGCGCCCCACGGAGGAAG AGGCGCTGGCTGAATGAAGAAC
A disintegrin-like and metalloprotease with thrombospondin type 1