Skip to main content

Advertisement

Table 1 Primer sequences, PCR conditions and restriction digestion predictions

From: P268S in NOD2 associates with susceptibility to Parkinson’s disease in Chinese population

Polymorphism Primer sequences (5′ → 3′) Annealing temperature (°C) Restriction enzyme Amplified products length (bp) Restriction products length (bp)
E46K F: TGATGTGGGAACAAAGGGGA 58 BsaJ I 747 46E allele: 287,460
  R: GTGTTTCCTGAAATGCACTCTGA     46K allele: 747
A1442P F: GAGACTAAACTGCTGCTTGC 58 Hha l 801 1442A allele: 671,130
  R: GTAATCTCGTATGGCAGGGA     1442P allele: 801
A350V F: TCAGTGGTCTTTGCGTCATT 58 Mwo I 302 350A allele: 94,208
  R: CTGTCCTTTTACTCTGCTCCC     350V allele: 302
P268S F: AGCCCATTGTCTGGTTAGGT 58 BamH I 309 268P allele: 309
  R: ACAGTGTCCGCATCGTCAT     268S allele: 225,84
R702W F: AGATCACAGCAGCCTTCC 63 MspI 185 702R allele: 20, 35, 54, 76
  R: CACGCTCTTGGCCTCACC     702W allele: 20, 35, 130
G908R F: CCCAGCTCCTCCCTCTTC 63 Hin6I 380 908G allele: 380
  R: AAGTCTGTAATGTAAAGCCAC     908R allele: 242, 138
1007fs F: GGCAGAAGCCCTCCTGCAGGGCC 58 ApaI 151 Wild type allele: 151
  R: CCTCAAAATTCTGCCATTCC     1007f allele: 130, 21
IVS9* F: ACTCCTGCGCTTGATTTAGGCAAT 58 Xho l 775 Wild type allele: 318,457
  R: TTGGAATTTAGCTGTTCCTTCGGG     IVS9 G → A allele: 775
G2385R F: AGACACTGCTCTCTATATTGCTAAG 58 Acc I 261 2385G:261
  R: CTGAAAAGATGGTGCTGAGAAG     2385R:77,184
  1. *: IVS9: Intervening sequence 9, PARK2.